SLC25A13, solute carrier family 25 member 13, 10165
N. diseases: 109; N. variants: 23
Source: ALL
Variant | Gene | Disease | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | GeneticVariation | CLINVAR | [SLC25A13 gene analysis in neonates with intrahepatic cholestasis caused by citrin deficiency]. | 21507300 | 2011 | ||||||
|
|
|
T | 0.700 | GeneticVariation | CLINVAR | Citrin deficiency, a perplexing global disorder. | 19036621 | 2009 | ||||||
|
|
|
T | 0.700 | GeneticVariation | CLINVAR | High resolution melting analysis for the detection of SLC25A13 gene mutations in Taiwan. | 21134364 | 2011 | ||||||
|
|
|
T | 0.700 | GeneticVariation | CLINVAR | Clinical, molecular and functional investigation on an infant with neonatal intrahepatic cholestasis caused by citrin deficiency (NICCD). | 24586645 | 2014 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | [Analysis of clinical features and SLC25A13 gene mutations in a family affected with neonatal intrahepatic cholestasis]. | 27577219 | 2016 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Application of mutation analysis for the previously uncertain cases of adult-onset type II citrullinemia (CTLN2) and their clinical profiles. | 12512993 | 2002 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | The gene mutated in adult-onset type II citrullinaemia encodes a putative mitochondrial carrier protein. | 10369257 | 1999 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Molecular analysis of SLC25A13 gene in human peripheral blood lymphocytes: Marked transcript diversity, and the feasibility of cDNA cloning as a diagnostic tool for citrin deficiency. | 23022256 | 2012 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | The gene mutated in adult-onset type II citrullinaemia encodes a putative mitochondrial carrier protein. | 10369257 | 1999 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Screening of nine SLC25A13 mutations: their frequency in patients with citrin deficiency and high carrier rates in Asian populations. | 14680984 | 2003 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Multiple ovarian antral follicles in a preterm infant with neonatal intrahepatic cholestasis caused by citrin deficiency: a clinical, genetic and transcriptional analysis. | 22710133 | 2012 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Molecular diagnosis of pediatric patients with citrin deficiency in China: SLC25A13 mutation spectrum and the geographic distribution. | 27405544 | 2016 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | The gene mutated in adult-onset type II citrullinaemia encodes a putative mitochondrial carrier protein. | 10369257 | 1999 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Molecular diagnosis of pediatric patients with citrin deficiency in China: SLC25A13 mutation spectrum and the geographic distribution. | 27405544 | 2016 | ||||||
|
|
|
T | 0.700 | CausalMutation | CLINVAR | Screening of nine SLC25A13 mutations: their frequency in patients with citrin deficiency and high carrier rates in Asian populations. | 14680984 | 2003 | ||||||
|
|
|
GT | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
GCCCGGGCAGCCACCTGTAATCTC | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR | |||||||||
|
|
|
A | 0.700 | CausalMutation | CLINVAR |